Определение мутаций генов FGFR3 и PIK3CA в ДНК из осадка мочи у больных раком мочевого пузыря

Михайленко Д.С., Перепечин Д.В., Ефремов Г.Д., Сивков А.В., Аполихин О.И.

Ежегодно в России регистрируют более 13 тыс. случаев рака мочевого пузыря (РМП), представляющего собой актуальную проблему современной онкоурологии [1]. В настоящее время для неинвазивной лабораторной диагностики РМП применяют рутинный цитологический анализ мочи, чувствительность которого составляет 25-50% при диагностике небольших высокодифференцированных опухолей. FISH-анализ осадка мочи (зонды на хромосомы 3, 7, 17 и 9р21), иммуноферментный анализ на UBC-антиген (цитокератины 8 и 18), BTA-тест или определение NMP22 с чувствительностью и специфичностью, близкими к 80-90%, имеют ограниченное применение в клинике [2]. Остается актуальной проблема поиска и характеристики новых молекулярных маркеров РМП, выявляемых в опухолевых клетках из осадка мочи и обладающих высокой диагностической точностью. 

В основе развития РМП лежат разнообразные молекулярно-генетические нарушения в соматических клетках: точковые мутации, протяженные делеции (потеря гетерозиготности) в областях локализации генов-супрессоров, амплификация онкогенов, аберрантное метилирование ДНК, изменения паттерна экспрессии регуляторных РНК и большого количества структурных генов [3]. Из всего перечисленного выше, точковые мутации обладают наибольшей потенциальной ценностью как диагностические маркеры, поскольку они являются частым событием канцерогенеза, могут быть выявлены в опухолевых клетках из осадка мочи (в том числе, при рецидиве заболевания) и представляют собой изменение ДНК, выявляемое рутинными молекулярно-генетическими методами [4, 5]. 

Около 90% случаев РМП представлены уротелиальной карциномой, у 80% пациентов наблюдают поверхностные и у 20% – мышечноинвазивные опухоли. За различиями в морфологической классификации, стадировании и прогнозе РМП стоят разные паттерны мутаций. Например, для инвазивного рака характерны множественные делеции районов локализации геновсупрессоров (3р, 5q, 14q, 9q и др.), самой частой из которых является делеция 9р21 с генами-супрессорами ARF, CDKN2A, CDKN2B, и он развивается через стадию дисплазии. Напротив, характерными чертами поверхностных опухолей являются активирующие мутации и гиперэкспрессия протоонкогенов (FGFR3, ERBB2, HRAS, и др.), поверхностный РМП (ПРМП) развивается через стадию гиперплазии, часто бывает мультифокальным и рецидивирующим [6, 7]. 

В настоящее время идентифицированы сотни мутаций в протоонкогенах, задействованных в канцерогенезе наиболее частой формы РМП – ПРМП. Среди них можно выделить точковые мутации, которые встречаются с частотой более 10% в первичных опухолях и локализованы в «горячих точках» мутагенеза. Это активирующие миссенсмутации в 7 и 10 экзонах гена рецептора фактора роста фибробластов 3 (FGFR3), 9 и 20 экзонах гена фосфотидилинозитолкиназы (PIK3CA). 

Ген FGFR3 локализован в области 4р16.3, содержит 19 экзонов, из которых в образовании полноразмерного транскрипта участвуют экзоны 2-18 [8]. По различным данным, от 50 до 80% первичного уротелиального рака при ПРМП несут мутации FGFR3, тогда как в инвазивных опухолях и их метастазах эта частота составляет не более 10% [7, 9]. Ген FGFR3 принадлежит к семейству генов трансмембранных рецепторов FGFR1-4, которые кодируют гликопротеины – рецепторы фактора роста фибробластов (FGF). Рецептор состоит из трех иммуноглобулин-подобных (Ig) доменов, обращенных в цитоплазму и связывающихся с сильным митогеном FGF1/2, трансмембранного домена и внутриклеточного тирозинкиназного домена, взаимодействующего со вторичными мессенджерами. После связывания с лигандом рецептор димеризуется и активирует тирозинкиназный домен. FGFR3 задействован в PIK3CA/AKT1 сигнальном пути. Почти все описанные миссенс-мутации находятся между Ig-подобными доменами или в трансмембранном домене, способствуя прочной димеризации и конститутивной активации FGFR3 по механизму образования дисульфидных мостиков или иных прочных взаимодействий. Локализация большинства точковых мутаций FGFR3 при ПРМП – экзон 7 (кодоны 248 и 249) и экзон 10 (кодоны 373 и 375) [7, 10-12]. 

Миссенс-мутации PIK3CA встречаются в 15-25% случаев ПРМП и значительно реже – при инвазивном РМП. Они локализуются, в основном, в спиральном домене (542 и 545 кодоны) и киназном домене (1047 кодон). Зачастую мутации сопряжены с потерей гетерозиготности (аллельными делециями) гена PTEN, продукт которого ингибирует сигнальный путь PIK3CA/AKT. Хотя мутации в указанных доменах обладают сходным трансформирующим эффектом в клеточных линиях, отношение частоты мутаций в киназном и спиральном доменах варьирует в зависимости от типа опухоли: от 0,29 в РМП до 2 в раке эндометрия, что указывает на возможные различия в механизмах активации сигнального пути PIK3CA/AKT [13]. 

Целью настоящей работы является комплексный анализ мутаций в 7-ом и 10-ом экзонах гена FGFR3, 9-ом и 20-ом экзонах гена PIK3CA в образцах геномной ДНК из осадка мочи у пациентов с ПРМП и контроля для разработки метода неинвазивной молекулярно-генетической диагностики ПРМП. 

МАТЕРИАЛЫ И МЕТОДЫ 

Выборки пациентов. Исследовали 22 образца осадков мочи от больных ПРМП, группу контроля составили 24 пациента с циститом и мочекаменной болезнью. 

Пробоподготовка. Собирали 10-30 мл первой порции мочи, центрифугировали при 3000 g в течение 15 мин, удаляли супернатант. Осадки замораживали при минус 70ºС. 

Получение образцов ДНК. Геномную ДНК из осадков мочи выделяли с помощью набора «ДНК-сорб В» (Интерлабсервис, Россия), при котором нуклеиновые кислоты сорбируются на носителе с последующей отмывкой спиртовыми растворами и эллюцией в ТЕ-буфер. 

Полимеразная цепная реакция (ПЦР). Проводили ПЦР участков гена FGFR3 с праймерами 7F:5’ – agtggcggtggtggtgagggag – 3’ и 7R:5’ – tgtgcgtcactgtacaccttgcag – 3’ (экзон 7), 10F:5’ – caacgcccatgtctttgcag – 3’ и 10R:5’ – aggcggcagagcgtcacag – 3’ (экзон 10). Программа амплификации для экзона 7 – 95ºС 1 мин 30 с, затем 35 циклов 95ºС 40 с, 64ºС 25 с, финальная элонгация 72ºС 40 с; для экзона 10 – 95ºС 1 мин 40 с, затем 35 циклов 95ºС 40 с, 62ºС 30 с, 72ºС 20 с, финальная элонгация 72ºС 1 мин. ПЦР участков гена PIK3CA проводили с праймерами 9F:5’ – gggaaaaatatgacaaagaaagc – 3’ и 9R:5’ – ctgagatcagccaaattcagtt – 3’ (экзон 9), 20F:5’ – ctcaatgatgcttggctctg – 3’ и 20R:5’ – tggaatccagagtgagctttc – 3’ (экзон 20) по программе, аналогичной амплификации экзона 10 гена FGFR3. Состав реакционной смеси ПЦР: 50-100 нг геномной ДНК, 2.5 мМ MgCl2, 1.5 мМ каждого dNTP, по 2 пмоль прямого и обратного праймеров, 1 ед. термостабильной Taq-полимеразы, 5 мкл буфера для ПЦР 5х (Интерлабсервис, Россия), объем смеси составлял 25 мкл. 

Секвенирование ПЦР-продуктов. Предварительно обрабатывали ПЦР-смесь 1 е.а. щелочной фосфатазы и 4 е.а. экзонуклеазы I из E.coli для удаления непрореагировавших праймеров и dNTPs. Затем проводили секвенирование ПЦР-продукта по Сэнгеру с помощью набора «BigDye Terminator v. 3.1 Cycle Sequencing Kit» на 24-х капиллярном секвенаторе 3500xl (Applied Biosystems, США) согласно рекомендациям фирмы-производителя. 

Статистический анализ результатов. Определяли частоту мутаций в группе ПРМП и сравнивали ее с контролем с помощью двустороннего точного критерия Фишера, используя программу GraphPadInStat. Поиск данных о выявленных мутациях и их патогенетическом значении осуществляли в международных базах данных HGMD (http://www.hgmd.cf.ac.uk), COSMIC (http://cancer.sanger.ac.uk/cosmic) и ClinVar http://www.ncbi.nlm.nih.gov/ clinvar">(http://www.ncbi.nlm.nih.gov/clinvar). 

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ 

Проведен комплексный анализ мутаций в ключевых онкогенах ПРМП, включающий ПЦР и последующее секвенирование экзонов 7 и 10 гена FGFR3, экзонов 9 и 20 гена PIK3CA (рис. 1). Были исследованы образцы ДНК из осадка мочи 22 больных ПРМП и 24 пациентов контрольной группы с неонкологическими заболеваниями мочевыделительной системы. Мутации были выявлены у 31,8% (n=7) пациентов с ПРМП, в контрольной группе мутации не обнаружены (р< 0,01). Из 7 случаев ПРМП с мутациями, в 6 образцах они были локализованы в гене FGFR3: 2 мутации – в седьмом и 4 мутации – в десятом экзонах. Еще одна мутация p.H1047R была детектирована в 20 экзоне гена PIK3CA (табл. 1). Аллели, отличающиеся от референсных, были сопоставлены с базами данных клинических ассоциаций с изменениями генома (HGMD, COSMIC, ClinVar) с целью выяснения патогенетической роли выявленных мутаций. За исключением мутации p.H251G и p.F386L, оставшиеся 4 однонуклеотидные замены были охарактеризованы как патогенные мутации в злокачественных опухолях. Наблюдаемое отношение частот мутаций FGFR3 к PIK3CA как 85:15 при ПРМП, в целом, соответствует данным других авторов [7, 12, 13].

Рис. 1. Примеры секвенирования мутаций в гене FGFR3

Таблица 1. Мутации FGFR3 и PIK3CA, выявленные в настоящей работе 

Ген Экзон Обозначение
мутации на
уровне кДНК
Обозначение
мутации на
уровне белка
Сведения в базе
данных HGMD (при
отсутствии – COSMIC)
Сведения в базе
данных ClinVar
FGFR3 7 c.746C→G p.S249C CM950470, патогенная rs121913483, патогенная
FGFR3 7 c.753С→G p.H251G нет в академической
версии
rs377554120, нет данных
FGFR3 10 c.1124A→G p.Y375C HGMD и COSMIC rs121913485, патогенная
FGFR3 10 c.1144G→C p.G382R CM960657, патогенная rs28931614, патогенная
FGFR3 10 c.1156Т→С* p.F386L* CM940785, патогенная rs17881656,
значение не установлено
PIK3CA 20 c.3140A→G p.H1047R HM040060,
возможно патогенная
нет в академической
версии HGMD,
COSM94986,патогенная
rs121913279, патогенная

Примечание: * мутация обнаружена в двух случаях ПРМП; базы данных: HGMD – Human genome mutation database, ClinVar public archive of relationships among sequence variation and human phenotype в структуре NCBI (The National Center for Biotechnology Information, США), COSMIC – Catalogue of Somatic Mutations in Cancer.

В уротелиальной карциноме чаще встречаются мутации в киназном домене (как и обнаруженная в образце ПРМП мутация p.H1047R), тогда как в опухолях других типов преобладают мутации в спиральном домене [14]. Одна из мутаций FGFR3 (p.H251G) отсутствовала в базах данных клинических ассоциаций, однако в 251 кодоне были описаны другие онкогенные миссенс-мутации. 

В настоящей работе показано, что определение мутаций FGFR3 к PIK3CA в осадке мочи с помощью ПЦР и секвенирования по Сэнгеру может быть использовано для выявления ПРМП. Однако частота мутаций FGFR3 в этой работе оказалась на 20-30% ниже, чем в исследованиях с применением методов целенаправленной амплификации и детекции мутантных аллелей. Вместе с тем, применение тест-систем для выявления мутаций FGFR3 методом аллель-специфичной ПЦР в реальном времени или ПЦР с последующим минисеквенированием показало целесообразность использования соматических мутаций этого гена как маркеров РМП в первичной диагностике заболевания [12, 15, 16]. 

Определение специфичных для ПРМП мутаций актуально не только при диагностике первичного РМП, но и при мониторинге рецидива. После удаления первичного ПРМП необходимо регулярно проводить цистоскопию, т.к. в 70% случаев в последующие годы развивается рецидив заболевания. Проведение цистоскопии сопряжено со значительным дискомфортом для пациента, анализ соматических мутаций в осадке мочи мог бы использоваться, как дополнительный критерий отбора пациентов для проведения этой диагностической процедуры [5].

Увеличение чувствительности теста может быть достигнуто, в том числе, за счет включения в список исследуемых локусов активирующих мутаций -124G→A и -146G→A в промоторе гена теломеразы TERT, которые встречаются в 60% случаев ПРМП [18].

Проблему низкого содержания мутантных аллелей FGFR3 на фоне избытка нормальной ДНК при мониторинге рецидива РМП пытались решить с помощью одной из платформ секвенирования следующего поколения, что позволило выявить мутации FGFR3 при доле мутантных аллелей, равной 0,02%. Однако в этом случае возникает вопрос о клинической значимости мутаций. Во-первых, соматические мутации FGFR3 могут возникнуть еще на стадии предраковых изменений до морфологически сформированной опухоли. Во-вторых, конкордантность результатов поиска мутаций в осадке мочи и первичной опухоли составляет не более 90% [18]. Отчасти различия в частоте мутаций могут также зависеть от стратификации выборки ПРМП по степени дифференцировки опухоли (в настоящей работе не было разделения по степени злокачественности вследствие малого объема выборки ПРМП).

По данным мета-анализов, активирующие мутации FGFR3 при ПРМП ассоциированы с ранней стадией заболевания и высокодифференцированной карциномой [11, 12]. Следует отметить, что при низкой частоте встречаемости мутаций FGFR3 при мышечно-инвазивном РМП, гиперэкспрессия этого гена наблюдается в 40% этих опухолей, а в 5% уротелиального рака и некоторых клеточных линиях РМП при отсутствии точковых мутаций FGFR3 выявлены химерные онкогены FGFR3:TACC3 и FGFR3:BAIAP2L1 [9, 19]. Это указывает на более значительную роль конститутивной активации FGFR3 при РМП в целом, чем значение описанного ранее онкогенного потенциала точковых мутаций в нескольких экзонах при поверхностном раке. 

ЗАКЛЮЧЕНИЕ

Таким образом, активирующие миссенс-мутации в «горячих точках» генов FGFR3 и PIK3CA были определены в осадке мочи у пациентов с ПРМП в 32% случаев с помощью ПЦР и последующего капиллярного секвенирования по Сэнгеру. При включении в панель исследуемых локусов промотора гена TERT и использовании аллель-специфичной ПЦР или иного метода для преимущественной амплификации мутантных аллелей на фоне избытка нормальной ДНК, возможна разработка системы маркеров для неинвазивной молекулярно-генетической диагностики ПРМП. 

ЛИТЕРАТУРА 

1. Злокачественные новообразования в России в 2012 году (заболеваемость и смертность). Под ред. А.Д. Каприна, В.В. Старинского, Г.В. Петровой. М.: ФГБУ «МНИОИ им. П.А. Герцена» Минздрава России. 2014. 250 с.

2. Чиссов В.И., Алексеев Б.Я., Русаков И.Г. Онкоурология: национальное руководство. М.: ГЭОТАР-Медиа. 2012; 688 c.

3. Mendelsohn J., Howley P.M., Israel M.A., Gray J.W., Thompson C.B. The Molecular Basis of Cancer. 4rd edition. Saunders, Philadelphia (USA), 2015.

4. Tan D., Lynch H.T. Principles of Molecular Diagnostics and Personalized Cancer Medicine. Lippincott Williams & Wilkins, Philadelphia (USA), 2013.

5. Zuiverloon T.C., Tjin S.S., Busstra M., Bangma C.H., Boeve E.R., Zwarthoff E.C. Optimization of nonmuscle invasive bladder cancer recurrence detection using a urine based FGFR3mutation assay. J. Urol. 2011; 186(2): 707-712.

6. Hoglund M. The bladder cancer genome: chromosomal changes as prognostic markers, opportunities, and obstacles. Urol. Oncol. 2012; 30(4): 533-540.

7. Knowles M.A., Hurst C.D. Molecular biology of bladder cancer: new insights into pathogenesis and clinical diversity. Nat. Rev. Cancer. 2015; 15(1): 25-41.

8. Pandith A.A., Zhah Z.A., Siddiqi M.A. Oncogenic role of fibroblast growth factor receptor 3 in tumorigenesis of urinary bladder cancer. Urol. Oncol. 2013; 31(4): 398-406.

9. Guancial E.A., Werner L., Bellmunt J., Bamias A., Choueiri T.K., Ross R., Schutz F.A., Park R.S., O'Brien R.J., Hirsch M.S., Barletta J.A., Berman D.M., Lis R., Loda M., Stack E.C., Garraway L.A., Riester M., Michor F., Kantoff P.W., Rosenberg J.E. FGFR3 expression in primary and metastatic urothelial carcinoma of the bladder. Cancer Med. 2014; 3(4): 835-844.

10. Dodurga Y., Tataroglu C., Kesen Z., Satiroglu-Tufan N.L. Incidence of fibroblast growth factor receptor 3 gene (FGFR3) A248C, S249C, G372C, and T375C mutations in bladder cancer. Genet. Mol. Res. 2011; 10(1): 86-95.

11. Liu X., Zhang W., Geng D., He J., Zhao Y., Yu L. Clinical significance of fibroblast growth factor receptor-3 mutations in bladder cancer: a systematic review and meta-analysis. Genet. Mol. Res. 2014; 13(1): 1109-1120.

12. Iyer G., Milowsky M.I. Fibroblast growth factor receptor-3 in urothelial tumorigenesis. Urol. Oncol. 2013; 31(3): 303-311.

13. Ross R.L., Askham J.M., Knowles M.A. PIK3CA mutation spectrum in urothelial carcinoma reflects cell context-dependent signaling and phenotypic outputs. Oncogene. 2013; 32: 768-776.

14. Millis S.Z., Bryant D., Basu G., Bender R., Vranic S., Gatalica Z., Vogelzang N.J. Molecular profiling of infiltrating urothelial carcinoma of bladder and nonbladder origin. Clin. Genitourin. Cancer. 2015; 13(1): e37-e49.

15. Silverberg D.M. Urothelial carcinoma of the upper urinary tract diagnosed via FGFR3mutation detection in urine: a case report. BMC Urol. 2012; 12: 20.

16. Kandimalla R., Masius R., Beukers W., Bangma C.H., Omtoft T.F., Dyrskjot L., van Leeuwen N., Lingsma H., van Tilborg A.A., Zwarthoff E.C. A 3-plex methylation assay combined with the FGFR3 mutation assay sensitively detects recurrent bladder cancer in voided urine. Clin. Cancer Res. 2013; 19(17): 4760-4769.

17. Allory Y., Beukers W., Sagrera A., Flandez M., Marques M., Marquez M., van der Keur K.A., Dyrskjot L., Lurkin I., Vermeij M., Carrato A., Lloreta J., Lorente J.A., Carrillo-de Santa Pau E., Masius R.G., Kogevinas M., Steyerberg E.W., van Tilborg A.A., Abas C., Orntoft T.F., Zuiverloon T.C., Malats N., Zwarthoff E.C., Real F.X. Telomerase reverse transcriptase promoter mutations in bladder cancer: high frequency across stages, detection in urine, and lack of association with outcome. Eur. Urol. 2014; 65(2): 360-366.

18. Millholland J.M., Li S., Fernandez C.A., Shuber A.P. Detection of low frequency FGFR3 mutations in the urine of bladder cancer patients using next-generation deep sequencing. Res. Rep. Urol. 2012; 4: 33-40.

19. Williams S.V., Hurst C.D., Knowles M.A. Oncogenic FGFR3 gene fusions in bladder cancer. Hum. Mol. Genet. 2013; 22(4): 795-803.

Прикрепленный файлРазмер
Скачать статью248 кб
рак мочевого пузыря, гены FGFR3 и PIK3CA, мутация